Separation of G structures formed by a 27-mer guanosine-rich oligodeoxyribonucleotide by dye-ligand affinity chromatography

G-DNA structures, formed by a 27-mer guanosine-rich oligodeoxyribonucleotide, AACCCGGCGTTCGGGGGGTACCGGGTT, were isolated and studied by dye-ligand affinity chromatography, using a Reactive Green 19-agarose resin (RG19-aga) and gel electrophoresis. The experiments were performed in the presence of Li+, Na+ and K+, which are able to stabilise the G structures to different extents. Desalting procedures followed by affinity chromatography, performed in the presence of Li+, gave us information on the relationships among the species isolated and their stability. The results show that the more stable species were those obtained in the presence of K+, while in the presence of Li+, the formation of G structures was negligible and the oligonucleotide was almost exclusively present as a stem-loop structure recognised by the RG19-aga affinity resin. Electrophoretic and denaturation and renaturation experiments supported the affinity chromatography results. (C) 1999 Published by Elsevier Science B.V. All rights reserved.